Review



crispr crrna sequence  (Synthego Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Synthego Inc crispr crrna sequence
    Crispr Crrna Sequence, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+crrna+sequence/crispr+crrna+sequence/bio_rxiv__2025__10__03__680197-183-1-20
    Average 86 stars, based on 1 article reviews
    crispr crrna sequence - by Bioz Stars, 2026-09
    86/100 stars

    Images

    Related Articles

    CRISPR:

    Article Title: Basal cytoplasmic calcium levels regulate C. elegans germ stem cell proliferation
    Article Snippet: .. The CRISPR crRNA sequence at the 3’ end of the inserted GCaMP7b coding sequence was GGGCGCGAGATGTTACTTGG, and was synthesized by Synthego. .. The P2A::wrmScarlet DNA sequence was synthesized by Azenta.

    Sequencing:

    Article Title: Basal cytoplasmic calcium levels regulate C. elegans germ stem cell proliferation
    Article Snippet: .. The CRISPR crRNA sequence at the 3’ end of the inserted GCaMP7b coding sequence was GGGCGCGAGATGTTACTTGG, and was synthesized by Synthego. .. The P2A::wrmScarlet DNA sequence was synthesized by Azenta.

    Synthesized:

    Article Title: Basal cytoplasmic calcium levels regulate C. elegans germ stem cell proliferation
    Article Snippet: .. The CRISPR crRNA sequence at the 3’ end of the inserted GCaMP7b coding sequence was GGGCGCGAGATGTTACTTGG, and was synthesized by Synthego. .. The P2A::wrmScarlet DNA sequence was synthesized by Azenta.



    Similar Products

    crispr crrna sequence  (Synthego Inc)
    86
    Synthego Inc crispr crrna sequence
    Crispr Crrna Sequence, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+crrna+sequence/crispr+crrna+sequence/bio_rxiv__2025__10__03__680197-183-1-20
    Average 86 stars, based on 1 article reviews
    crispr crrna sequence - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    dna sequences and crispr rna (crrna)  (Sangon Biotech)
    90
    Sangon Biotech dna sequences and crispr rna (crrna)
    Dna Sequences And Crispr Rna (Crrna), supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+crrna+sequence/crispr+rna++crrna+/pm39308213__ac4c03959_si_001-13-1-12
    Average 90 stars, based on 1 article reviews
    dna sequences and crispr rna (crrna) - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    20 base pair crispr-rna (crrna) sequences  (Benchling Inc)
    90
    Benchling Inc 20 base pair crispr-rna (crrna) sequences
    20 Base Pair Crispr Rna (Crrna) Sequences, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+crrna+sequence/20+base+pair+crispr+rna++crrna++sequences/pmc11251090-333-1-9
    Average 90 stars, based on 1 article reviews
    20 base pair crispr-rna (crrna) sequences - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    alt r crispr cas12a crrna targeting sequence ggatgctgtgtccagcttatgctt  (Danaher Inc)
    86
    Danaher Inc alt r crispr cas12a crrna targeting sequence ggatgctgtgtccagcttatgctt
    Alt R Crispr Cas12a Crrna Targeting Sequence Ggatgctgtgtccagcttatgctt, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+crrna+sequence/bio_rxiv__2023__12__19__572386-179-3-9
    Average 86 stars, based on 1 article reviews
    alt r crispr cas12a crrna targeting sequence ggatgctgtgtccagcttatgctt - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    crispr rna crrna sequences  (Danaher Inc)
    86
    Danaher Inc crispr rna crrna sequences
    Crispr Rna Crrna Sequences, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+crrna+sequence/pm37938828-283-9-21
    Average 86 stars, based on 1 article reviews
    crispr rna crrna sequences - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    polynucleotides for expressing crrna corresponding to the spacer sequence of e. coli crispr  (Hokkaido System Science Co)
    90
    Hokkaido System Science Co polynucleotides for expressing crrna corresponding to the spacer sequence of e. coli crispr
    Polynucleotides For Expressing Crrna Corresponding To The Spacer Sequence Of E. Coli Crispr, supplied by Hokkaido System Science Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+crrna+sequence/polynucleotides+for+expressing+crrna+corresponding+to+the+spacer+sequence+of+e++coli+crispr/us11807869-293-32-50
    Average 90 stars, based on 1 article reviews
    polynucleotides for expressing crrna corresponding to the spacer sequence of e. coli crispr - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    nucleotide protospacer sequence crrna  (Danaher Inc)
    95
    Danaher Inc nucleotide protospacer sequence crrna
    Nucleotide Protospacer Sequence Crrna, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+crrna+sequence/Alt-R+CRISPR-Cas9+Negative+Control+crRNA/bio_rxiv__2023__05__05__539557-335-2-6
    Average 95 stars, based on 1 article reviews
    nucleotide protospacer sequence crrna - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    cas9 crrna sequence  (Danaher Inc)
    95
    Danaher Inc cas9 crrna sequence
    Cas9 Crrna Sequence, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+crrna+sequence/CRISPR-Cas9+crRNA/bio_rxiv__2023__01__11__523593-62-25-32
    Average 95 stars, based on 1 article reviews
    cas9 crrna sequence - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    fragment containing the intact j23119 (spei) promoter and the front sequence of crispr rna (crrna)  (GenScript corporation)
    90
    GenScript corporation fragment containing the intact j23119 (spei) promoter and the front sequence of crispr rna (crrna)
    Fragment Containing The Intact J23119 (Spei) Promoter And The Front Sequence Of Crispr Rna (Crrna), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+crrna+sequence/fragment+containing+the+intact+j23119++spei++promoter+and+the+front+sequence+of+crispr+rna++crrna+/pmc09431524-179-2-20
    Average 90 stars, based on 1 article reviews
    fragment containing the intact j23119 (spei) promoter and the front sequence of crispr rna (crrna) - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results